Journal of Veterinary Research
Year:2015 | Volume:70 | Issue:4|Papers Count:17

BACKGROUND: One of the most important heart diseases in dogs is valvular insufficiency, which can be evaluated by methods such as phonocardiography, echocardiography, etc.OBJECTIVES: The purpose of the current study was to evaluate of valvular insufficiencies with phonocardiography and echocardiography and using phonocardiography technique in detection of cardiac valvular insufficiency in practice.METHODS: This survey was conducted on 180 five-year-old dogs of which 30 had valvular disease. They have been referred to radiology section and echocardiography technique was used after listening to heart sounds and recording heart murmur and surveying by phonocardiography. The type and location of valvular insufficiency was diagnosed by phonocardiography and then echocardiography was used; the results from both techniques were compared afterwards.RESULTS: In all of these 30 dogs, murmur was systolic and mitral insufficiency and mitral regurgitation was diagnosed by phonocardiography. Using echocardiography, the mitral insufficiency was confirmed in 28 dogs, one of them has been diagnosed with tricuspid insufficiency and pulmonary stenosis in addition to mitral insufficiency. In two cases no abnormality sign has been detected.CONCLUSIONS: According to this study, it is recommended to use phonocardiography technique in order to pre-diagnose the valvular disease, its type and location and use echocardiography to determine the process of disease and control this progress.

BACKGROUND: AmpC and ESBLs as mediated-plasmid extended spectrum b-lactabases are the main factors of resistance to extended-spectrum cephalosporins in enterobacteriacea especially E. coli and will follow treatment failure, high costs of treatment in human and economic losses in the poultry industry.OBJECTIVES: The purpose of this study was to screen and study the faecal E. coli isolates producing extended spectrum b-lactamases (ESBLs) and AmpC enzymes and related workers.METHODS: A total of 500 cloacal swab samples from broiler chickens and 25 rectal swab samples from workers were collected from five poultry houses around Tehran. All samples were seeded on MacConkey agar and identification of E. coli isolates were performed via biochemical tests. Antibiotic susceptibility was determined against 12 antibiotics using the disk diffusion method as recommended by the clinical and laboratory standard institute (CLSI2012). Ceftazidim/ ceftazidim-clavolanic acid and cefoxitin/ cefoxitin-EDTA disks were used for the detection of ESBL and AmpC phenotypes, respectively. phonetic analysis of the drug resistances was performed via SPSS software and Chi-square test. ESBL- producing E. coli screened by PCR for the presence of genes encoding beta-lactamases of TEM, CTX-M and SHV.RESULTS: A total 467 E. coli isolates were isolated from 88.9% of the samples as 92% and 72.7% of isolates presenting MDR phenotype among chickens and workers respectively. ESBL phenotype detected in 5.5% (26) of poultry isolates while, none of the workers isolates have this phenotype. Six isolates carried both of TEM and CTX-M whereas, five and one isolates were detected only for TEM and CTX-M, respectively. Eighty-eight and nine-tenths percent of ESBL E. coli displayed AmpC phenotype.CONCLUSIONS: Since cephalosporins are not used in broilers in Iran, isolation of faecal E. coli isolates producing extended spectrum b-lactamases in broilerchickens can indicate transfer of the resistance genes via plasmids and other mobile genetic elements among Enterobacteriaceae.

BACKGROUND: Brucellosis is one of the most important zoonosis that is prevalent among human and animal. Today, a large percentage of animal and human population suffer from its side effects.OBJECTIVES: The purpose of the present study was to estimate the prevalence of anti-Brucella antibodies in flock- and animal-level in districts of south of Kerman province.METHODS: In this cross-sectional study, 300 herds of 7 districts in the area were selected randomly; 10 samples of sheep and goats in each flock were randomly selected. Out of 3000 samples, 2952 samples were examined using Rose-Bengal test; Wright and 2-ME tests were done on positive samples. Descriptive statistics and logistic regression in Stata 11.2 were used to analyze the data.RESULTS: The seroprevalence of anti-Brucella antibodies in animal- and flock-level was 6.4 and 25.3 percent, respectively. The chance of being infected in sheep was 2.12 times of goats.CONCLUSIONS: The prevalence of Brucella was considerably high in animal- and herd-level in this area. It is necessary to empower Iran Veterinary Organization in financial aspects to control this infection.

BACKGROUND: Adiponectin is one of the most important adipocytokines that regulate male and female fertility via AdipoR1 and AdipoR2 receptors. Recently expression of adiponectin system and its negative regulatory role on hypothalamus-pituitary axis have been confirmed.OBJECTIVES: No information is available about the expression pattern of adiponectin and its receptors in hypothalamus-pituitary axis in domestic animals. Here for the first time, we studied hypothalamus-pituitary adiponectin system gene expression in different stages of bovine estrous cycle.METHODS: Anterior pituitary and hypothalamus were collected from Holstein cow at the local abattoir. The estrous cycle was classified to four phases (proestrous, metstrous, early luteal and late luteal) based on macroscopic examination of ovaries and uteri. Gene expression analysis of adiponectin and its receptors was done using quantitative real time PCR (qPCR Probe MasteKit) and according to the comparative 2-DDCt method. E2 and P4 levels were measured using ELISA method.RESULTS: Our results demonstrated that adiponectin and its two receptors were expressed in pituitary and hypothalamus of cyclic cow. Maximal expression of adiponectin was observed in early luteal phase, while it was expressed at minimal level during the proestrous stage. We observed no significant changes in the expression of AdipoR1 in both tissues at different stages of estrous cycle. The highest expression of AdipoRII in both tissues was detected during the proestrous stage, while it expressed at minimal level during the late luteal phase. E2 and P4 had respectively negative and positive correlations with adiponectin expression levels in hypothalamus and pituitary.CONCLUSIONS: Based on our results that demonstrated adiponectin was minimally expressed at proestrous stage and other data about the negative action of adiponectin on LH secretion from pituitary, we concluded that adiponectin may has role in the hormonal function of this axis during the estrous cycle.

BACKGROUND: High grain diets in ruminants increases the risk of digestives disorders such as acidosis which may lead to high economic loss.OBJECTIVES: This experiment was conducted to determine the effects of an unsaturated and polyunsaturated fatty acid and monensin on gene expression of enzymes involved metabolic pathway of cell proliferation and rumen epithelial intracellular pH regulation.METHODS: Twenty two male Afshari lambs with live body weight of 45±8 kg and six month age were used in a completely randomized design with 3 treatments replicates for 77 days including 21 days adaptation period. Experimental diets were consisted of a basal high concentrate diet (16% CP and 2.75 Mcal/kg ME) and 1) no additive (control, C=8 lambs), 2) 30 mg monensin/day/head during the whole experimental period (T1=8 lambs), and 3) (polyunsaturated fatty acidduring the whole experimental period (T2=6 lambs). Lambs were killed after 77 days on the treatment diets.RESULTS: Compared with the C treatment, relative abundance of mRNA of monocarboxylate transporter isoforms MCT1, MCT4 and the ketogenic enzyme 3-hydroxy-3 methyl-glutaryl CoA-synthase (HMGCS2) were higher for the T1 treatment. The expression of cholesterolgenic enzyme HMGCS1 was down-regulated for the T1 treatment and that of HMGCS1 was up- regulated for the T2 treatment. The expression of MCT1 and MCT4 were down-regulated for the T2 treatment. Monensin had an additional impact on the mRNA abundance of epithelial SCFA- and acid-base transporters with concurrent changes in rumen epithelial thickness.CONCLUSIONS: The results suggest that adding monensin and oil as nutritional means to reduce acidosis cause changes in mRNA expression of VFA transferring proteins and limiting enzyme in the synthesis of cholesterol and Ketone bodies in the rumen epithelium.

BACKGROUND: Brucellosis is one of the most common zoonosis in Middle East and Iran.OBJECTIVES: The purpose of this study was genomic detection of Brucella spp. in sero-positive dairy cattle.METHODS: We have collected 28,519 blood samples from cows during 2012-2013. Samples were screened by Slide and tube agglutination and 2-Mercaptoethanol tests. Samples with anti-Brucella antibodies titer³1:80 and³1:40 in tube agglutination and 2-ME tests were considered as positive respectively. Tissue samples include: lymph nodes, liver, testicle and kidney from 122 samples of slaughtered cows were collected. The Sero-positive samples were examined by a collection of specific primers for Brucella abortus, Brucella melitensis, vaccinal strains included RB51 and Rev1 using PCR tests.RESULTS: Results showed that 450 samples were positive in slide agglutination test and 447 samples had anti-brucella antibodies titer equal to or more than 1:80. So they were positive by tube agglutination test. Three hundred eighty nine samples were positive by 2-mercaptoethanol test. PCR test results showed that 46 samples (37.7%) out of 122 samples had a specific sequence of Brucella or otherwise they have an active infection with Brucella species, whereas 62.3% of samples were negative. The PCR results showed that 2 samples (4.35%) were infected by B. melitensis, 2 samples (4.35%) infected by Rev1 strain and 42 samples (91.3%) were infected by B. abortus.CONCLUSIONS: The results showed that, as we had expected, the majority of cows were infected by B. abortus. Animals who infected by B. melitensis and Rev1 strain may be a result of contact with sheep or goats. We couldn’t find Brucella genome in 76 samples (62.3%) of sero-positive cows. It may be caused by cross reaction of sera with Brucella species in tests or activation of immune system response and elimination of organism from internal organs.

BACKGROUND: Fibroblasts are one of the important cells in wound healing. These cells create a proper bed for keratinocytes migration and wound contraction. Wound healing in distal limb of horses has complications, such as formation of exuberant granulation tissue (EGT). The main factor in this problem is overgrowing of fibroblasts.OBJECTIVES: The purpose of the present study was to compare fibroblast growth curve in isolated skin from horses’ neck and distal limb.METHODS: 5 horses with normal hematological and clinical signs were selected. Two samples of full thickness of skin were taken from the neck and lateral metacarpal region of each horse aseptically. Then the samples were washed with PBS minced and placed in ventilated flask 25 cm2. After attaching samples to flask, 5 ml culture medium (RPMI-1640 with 10% FBS) were added and the flask was placed in an incubator at 37oc in 5% CO2. After leaving a sufficient number of cells from tissues adhered to the bottom of the flask, the cells were passaged to a new ventilated flask. After growth and proliferation of cells, they were passaged again and a suspension of cells in culture medium (10000 cells/ml) was maked. To each cell of a 24-well plate, one ml of this suspension was added. After 48 hour, cells of 3 well were detached with tripsin daily, counted and viability determinted within 8 days.RESULTS: There was no significant difference between viable cells number but there was significant difference in viability percent of cells in neck and distal limb. The mean of population doubling time (PDT) for fibroblasts of neck is 31.73 hours and for fibroblasts of distal limb is 26.4 hours. This difference was not significant.CONCLUSIONS: With regard to different viability percentage, it seems that the appoptosis in fibroblasts of neck skin is more regular than distal limb skin.

BACKGROUND: Reptiles, especially turtles that inhabit both on land and water, have made some special adaptations. Many people keep turtles as pets. Therefore, the anatomical knowledge of turtles should be more carefully evaluated and used for therapeutic purposes. One of these turtles is European pond turtle (Emys orbicularis). Most of vital systems are enclosed by the carapace and the plastron so it cannot be examined customarily by clinicians. The noninvasive diagnostic imaging techniques provide detailed information concerning these organs.OBJECTIVES: This study was conducted to give complete topographic information and knowledge about the position of the non respiratory organs of the coelomic cavity in the European pond turtle using Computed Tomography (CT) and usual anatomic methods.METHODS: 10 adult turtles (5 female, 5 male) were selected. All scans were obtained on a two detector scanner. In anatomical study three female and three male turtles were dissected. Two other female and male turtles were sectioned transversely.RESULTS: The results showed some differences in the position of the organs including stomach, gall bladder, liver and heart with those of other species. Moreover, the topography of the organs is described in retracted and protruded neck in this article. Retraction of the neck had an influence on the position of the organs such as oesophagus, stomach, liver and heart.CONCLUSIONS: The general morphological features of the non respiratory organs of the coelonic cavity of European pond turtle were examined by CT images and macroscopically in this study. Significant differences were found compared with other species.

BACKGROUND: SDFT, DDFT and suspensory ligament are the most important tendons and ligament of the palmar aspect of the metacarpus that contribute to stability mechanism.OBJECTIVES: The purpose of this study was to describe the tendons and ligaments of the palmar surface of metacarpus in Anatoly donkey and compare them with those in horse.METHODS: 14 healthy Anatoly donkeys without lameness were selected to detect the tendons, ligaments and their accessories on the palmar surface of metacarpus in both left and right forelimbs after euthanasia. 4 horses were also selected and their tendons and ligaments in palmar surface of metacarpus were compared with those in Anatoly donkeys.RESULTS: DDFT and suspensory ligament in this region were similar in Anatoly donkeys and horses but SDFT in Anatoly donkeys had an accessory ligament in the palmar surface of the metacarpus that was originated from the deep fascia of carp after the carpal joint and was joined to the SDFT.CONCLUSIONS: This second accessory ligament of SDFT has not been observed in the studied horses and has never been reported in the related references. The results of this study can be used in to diagnose and treat lameness in Anatoly donkeys by radiologists and surgeons.

BACKGROUND: Fish are constantly exposed to various pathogens and parasites in particular. Gyrodactylus from Platyhelminthes is an important monogenean ectoparasite that can cause disease and economical losses to cultured, wild, salt and fresh water and ornamental fish. Gyrodactylus appears to be one of the most prevalent parasites of ornamental fish especially in Cyprinids.OBJECTIVES: The present study aimed to identify morphometric and molecular characteristics of Gyrodactylus parasite on Carassius auratus (Linnaeus, 1758).METHODS: Gyrocactylus parasites were isolated from skin, fins and gills of the fish with wet mount slide and were examined under light microscopy. The morphometrical characterization of Gyrodactylus specimens was performed using the measurements and drawings of opisthaptoral hard parts of the parasites. The molecular species description was based on polymerase chain reaction (PCR) of partial sequence of 5.8S region of ribosomal RNA (5´CGATCATCGGTCTCTCGAAC3´) and partial sequence of internal transcribed spacer2 (ITS2) of ribosomal RNA (5´TTAAGGAAGAACCACTAGAG3´).RESULTS: Gyrodactylus species morphology identification was performed using Yamaguti (1961) identification key. The nucleotide sequences of the PCR products were compared with GenBank sequences.CONCLUSIONS: Based on morphometric analysis and sequencing, the Gyrodactylus specimens were described as Gyrodactylus kobayashi. Combination of molecular techniques with morphological analysis seems to be the best approach to identification of Gyrodactylus spices.

BACKGROUND: Freshwater pulmonate family Lymnaeidae are well-known for their role in transmission of diginean trematodes worldwide.OBJECTIVES: The study was aimed to investigate the ecology and effects of physical and chemical components of the environment on their distribution and populaion density.METHODS: The lymnaeid snails were randomly collected from 16 freshwater habitats in West Azarbaijan Province and water samples were also provided from the habitats for chemical analysis.RESULTS: The distribution patterns of the lymnaeid snails in all the examined sites were almost identical throughout the year except in winter. The snails were mostly found in lentic waters or slow-moving streams with muddy beds. The population densities of Lymnaea auricularia, L. gedrosiana and L. stagnalis significantly differed among the investigated waters during the course of study. The concentration of nitrate had significant positive correlations with the snails’ density while there was no significant correlation between nitrite or phosphate concentration with the population density and body size.CONCLUSIONS: The results indicated that distribution and density of the snails were affected by season and physicochemical characteristics of environments. These results can be useful for launching the control programs against parasitic trematodes in the region.

BACKGROUND: Sarcocystis infection is one of the most common zoonotic protozoon diseases caused by different Sarcocystis spp.OBJECTIVES: Due to the importance of this infection in public health, the infection rate of macroscopic and microscopic cysts in sheep and cattle of abattoir of Shahriar, was investigated.METHODS: 138 slaughtered sheep and cattle were selected randomly and their esophagus, diaphragm, heart, tongue, masseter and intercostal muscles were separated. In order to find cysts, the samples were examined by two methods: direct observation for macroscopic cysts and finding microscopics cysts by smear dab, Giemsa staining and microscopic investigation for bradyzoites of parasite.RESULTS: In slaughtered samples, there was no macroscopic cyst but microscopic cysts were positive in 93.48% of cattle and 86.95% of sheep by impression smear method. The results showed the significant difference between different muscles and microscopic cysts (p<0.05) .Heart and esophagus were the most infected and tongue was the least infected part. Infections in males were more than females in both sheep and cattle. There was no significant different in various ages of cattle, however, infection in sheep less than one year old, were higher than the other ages.CONCLUSIONS: Due to the heavy Sarcocystis infection in meat of cattle and sheep and the importance of this parasite in public health, it is suggested to avoid eating raw and undercooked meat and conduct preventive measures such as closer inspection of carcasses and local or total removal of slaughtered in abattoir.

BACKGROUND: Enhancement of the immune system seems to be the most promising method of preventing fish diseases and increasing growth rate.OBJECTIVES: The purpose of the present study was to investigate the influence of dietary administration of Zataria multiflora Boiss and Menthapulegium L extracts on phagocytosis, lysozyme, respiratory burst and total white and red blood cells (WBC/RBC) of rainbow trout (Oncorhynchus mykiss).METHODS: Two hundred and ten fish (100±10 g) were used in a completely randomized design with 7 treatment and 3 replicates in a 2 weeks period (from 0 to 14 d). The basal diet supplemented with 0 (control), 20, 50 and 100 mg/kg food Z. multiflora and M.pulegium extracts. At the end of the experiment (after 14 days), samples from kidney and blood of the fish were collected in order to determine WBC/RBC (by neubauer chamber), serum lysozyme activity (by turbid metric assay, phagocytosic (by number of yeast cells phagocytosed method) and respiratory burst activities (by reduction of nitroblue tetrazolium method) of head kidney tissue.RESULTS: The results indicated that the highest ratio of phagocytosis and respiratory burst activity was observed in 50 mg/kg extract concentration of Z. multiflora (p<0.05). The highest WBC lysozyme activities were seen in 100 mg/ kg extract concentration of Z. multiflora. No significant difference was shown between RBC in treatment groups and control group (p>0.05). The highest ratio of phagocytosis activity was observed in 100 mg/kg extract concentration of M. pulegium (p<0.05). No significant difference was observed between WBC/RBC, lysozyme, respiratory burst means in treatment groups and control group (p>0.05).CONCLUSIONS: It can be concluded that 50 and 100 mg/ kg of the methanol Z. multiflora and 100 mg/kg M. pulegium have positive effects on stimulating of innate immune system in O.mykiss, but the influence of Z. multiflora extract with100 mg/kg concentration is better than M. pulegium extract.

BACKGROUND: The repetitive use of antibiotics in different fields (veterinary and medicine) improves the emergence and occurrence of the resistance phenomenon in pathogenic bacteria. Due to the problem of antimicrobial resistance, it is an urgent need to discover new drugs and alternative treatments for the control of bacterial diseases in aquaculture.OBJECTIVES: The purpose of this study is to investigate antibacterial effects of methanol and hexane extracts of medicinal plants Rattles (Prosopis farcta), datura (Datura stramunium L) and milkweed (Calotropis procera L), the major pathogenic bacteria of fish, including Aeromonas hydrophila, Yersinia ruckeri and Streptococcus iniae.METHODS: Extraction was performed using a rotary evaporator. To determine the minimum inhibitory concentration (MIC), the standard microdilution method (Dilution in broth) was used and the minimum bactericidal concentration (MBC) was determined based on MIC values obtained for each extract.RESULTS: The results showed that the effect of most potent extract, methanol extract obtained from fruit rattle on the three studied bacteria, with MIC and MBC are 25, 50 mg/ml, respectively. The most sensitive bacteria to methanol and hexane plant extracts, is bacterium Streptococcus iniae and Aeromonas hydrophila and Yersiniaruckeri bacteria were resistant. The studied extracts had stronger antibacterial properties against gram-positive bacteria compared to gram-negative.CONCLUSIONS: According to the results, it seems that the use of methanol extract of Prosopis farcta fruit is effective for treatment of bacterial diseases in aquaculture.

BACKGROUND: Probiotics, in form of microbial supplements, are known to be a suitable alternative for antibiotics and can affect the health indicators of host.OBJECTIVES: The present study was conducted to assess the combined effects of dietary autochthonous Saccharomyces cerevisiae and Aspergillus niger on haematological and serum biochemical parameters of beluga sturgeon (Huso huso) juveniles.METHODS: This study was based on a completely randomized design with 4 treatments and 3 replicates on beluga juveniles with average weight of (mean±SE) 31.8±2.81g. Beluga Juveniles were divided randomly into 12 fiber glassy tanks with density of 30 fish per tank and were fed with diet contain dietary probiotic with density of 2´106 (Cells/g) for the first treatment, 4´106 (Cells/g) for the second treatment, 6´106 (Cells/g) for the third treatment and basal diet without probiotic for the control group for 8 weeks.RESULTS: Diet supplementing with concentration of 6´106 (Cells/g), significantly improved serum biochemical parameters (p<0.05), however hematological parameters were affected by supplemented diet with probiotics that showed no significant difference in comparison with the control group (p>0.05). Also results indicate that growth factors were improved in experimental treatments in comparison with the control group.CONCLUSIONS: The results showed that the use of combination of these species with studied concentrations can improve the performance of some biochemical parameters such metabolites factors, immune, enzymes and serum electrolytes of belugajuveniles. It is recommended that the concentration of A. niger and S. cerevisiae, used for third treatment be used as an immune stimulator for beluga juveniles.