Objective: Finding a suitable laboratory test that can diagnose schizophrenia in its early stages could be very important. According to the hypothesis of lack of noradrenalin balance in the brain, it is illustrated that the disorder severity has a negative correlation with the amount of urine noradrenalin metabolite [3-methoxy-4-hydroxy phenyl glycol (MHPG) sulfate]. In this research, instead of measuring 24-hour urine MHPG sulfate level by standard expensive HPLC method, 24-hour urine organic sulfate mixtures were measured and compared between schizophrenic patients and control group by Colorimetry.Methods: Forty schizophrenic patients (20 males and 20 females) diagnosed by two psychiatrists according to DSM-IV-TR criteria and 40 controls (20 females and 20 males) with nearly the same diet and physical activity levels were included. After primary laboratory tests and ruling out general medical conditions in both groups, all medications in schizophrenic patients were tapered. For all subjects, 24-hour urine samples were collected and organic sulfate was measured by Colorimetry method.Results: Mean 24-hour urine organic sulfate in case and control groups were 0.465±0.03 and 0.475±0.04, respectively (p=0.219). Mean 24-hour urine organic sulfate in case females was 0.46 ± 0.028 g/dl. In control females, this amount was 0.47±0.044 g/dl (p=0.393). Mean 24-hour urine organic sulfate in case males was 0.47±0.031 g/dl. In control group, it was 0.48±0.039 g/dl (p=0.382).Conclusion: Measuring organic sulfate by Colorimetry method cannot help to distinguish schizophrenic patients from normal individuals.

This research was done to study the thermal and colorimetric properties of bleached wheat straw/polyethylene biocomposites. Thus, wheat straw was bleached using different natural and/or chemical bleaching methods. The bleached wheat straw and the pure polyethylene were then mixed in ratio of 40 to 60 by twin screw extrouder at 145OC. Maleic anhydride polyethylene was also applied in %10 of polyethylene weight. Thermal and colorimetric properties of treatments were evaluated and compared to control sample (pure polyethylene). The results showed that the unbleached wheat straw composite had the lowest lightness value. Biocomposites containing bleached wheat straw pulp with xylanase and hydrogen peroxide 1% had the highest lightness value after pure polyethylene. The results of the thermal behavior of the composites from DSC curves showed that the melting temperature of bleached wheat straw pulp with xylanase and hydrogen peroxide1% composite was higher than pure polyethylene and the others. The maximum and the minimum decomposition temperature of the composites belonged to the unbleached wheat straw (424.76oC) and the bleached wheat straw pulp (354.23oC), respectively.

2Introduction: When the size of a material is reduced to the nanometer length scale, the electron properties and therefore its chemical properties change greatly. In nanoparticles such as gold and silver, the coherent oscillation of electrons in the conduction strip creates large surface electric fields which, when they interact with electromagnetic resonance radiation, their radiant properties rises sharply. This process causes the absorption process of these nanoparticles to be several times stronger than the absorption process of the strongest adsorbent molecules and their scattered light is several times more intense than the organic materials fluorescence. These unique properties provide a high potential for these nanoparticles to be used in many applications such as biochemical sensors, biomedical imaging and medical treatments. Aptamers are single-stranded oligonucleotides, DNA, RNA or proprietary proteins that have the ability to attach specifically to their target. The basis for identifying the target by aptamers is the third structure formed by them. One of the important benefits of aptamers to antibodies is their smaller size, which makes them more easily and effectively penetrated. It also has neither toxicity nor immunogenicity unless in very low levels. Therefore, biosensors that use aptamers as biological identifiers are known as aptasensors. In this research, due to the high losses caused by aflatoxins to the crops and their toxicity, the rapid detection of these pesticides by aptasensor method was investigated. Materials and methods: The test was carried out in a 96-well plate and for each concentration three replicates were considered. In each test, 100 μ l of the nano gold solution, which was centrifuged twice at 12000 rpm and at room temperature, was thrown into 11 concentrations and three repetitions in the plate houses. Then adding 15 μ lit of aptamer at a concentration of 5 μ mol plus 10 μ lit of distilled ultrapure water to the houses and incubate for 30 minutes at room temperature. After this time, 25 μ lit of different concentrations of aflatoxin plus 15 μ lit of 2 molar salt solutions and 35 μ lit of distilled water were added to the houses and, after mixing (up and down) in the ELISA reader, absorbed it we read. Results and discussions: At first, with adding the aptamer to Nano gold particles a complex between nanoparticles and aptamer is created. But in present of suitable aflatoxin, the complex of nanoparticle and aptamer is separated and a new complex between aflatoxin and nanoparticle is formed. Subsequently the color is changed to purple. This color change is visible to the eye, indicating that the Aptamer is suitable for Target. In this study, it was found that an aptamer with GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA sequence only affects aflatoxin G1 and other aflatoxins such as B1, B2, and G2 should be considered as another sequencer for Aptamer.

In this research, the europium Eu-activated SrZn2Si2O7 phosphors were successfully prepared by sol-gel method in reductive and oxidative atmospheres. Thermogravimetric-differential thermal analysis (TG-DTA), X-ray diffraction (XRD), scanning and transmission electron microscopy (SEM and TEM) and photoluminescence (PL) spectra were used to characterize the resulting products. Obtained phosphor in reductive atmosphere is efficiently excited in the wavelength range of 350-390 nm which matches to a near UV (NUV) emitting InGaN chip and emits strong band blue light peaking at 481 nm with color coordination x=0.176, y=0.193 due to 4f65d1(2D)®4f7(8S7/2) transition of Eu2+ ions. Also, synthesized phosphor in oxidative atmosphere emits at approximately 480 and 600 nm that attributed to f-d transitions of Eu2+ and f-f electronic transitions of Eu3+, respectively. Finally, the crystallite size of the products was estimated about 30 nm by using Scherrer’s equation that this measurement was consistent with TEM observations.

This paper reports the luminescence properties and Colorimetry of Eu2+ activated SrMgAl2SiO7 pigments prepared via a solgel method. Effect of calcination time on pigment properties has been characterized by X-ray diffraction (XRD) and spectrophotometer. Furthermore, microstructure has been studied by Scanning Electron Microscope (SEM). By using scherrer equation, it was realized that the crystallite size of the synthesized powder increases as time of calcination increases and crystallite size of final product was estimated 30-40 nm. Investigation of luminescence properties, illustrated that Eudoped nanocrystals when exposed to 260 nm UV light, showed a uniform and relatively pure blue color that is related to the 4f7 ® 4f65d1 transition of Eu2+ in the phosphor lattice with color coordination (x = 0.187, y = 0.077). Furthermore, it was found that the color purity of the pigment increases as calcinations time increases.

Color and appearance are among the first parameters perceived by consumers to judge the quality of foods. L*a*b* are used to report foods' colors quantitatively. In this study the use of digital imaging and Photoshop software was evaluated for measurement of L*, a* and b* color parameters. The results showed that L*, a*, and b* values from Hunter colorimeter and the digital imaging method had a good correlation with R2 more than 0.95, but the values from digital imaging method can be used only to monitor the trend of color changes and the actual numbers of digital imaging L*, a* and b* obtained by digital imaging do not have the same value as the L*, a* and b* given by a Hunter colorimeter. Using two equations for the three parameters the values obtained from digital imaging method can be successfully converted to Hunter Lab color corresponding parameters. The color change of Mazafati date during accelerated ripening using acetic acid solutions was monitored by the proposed method. L*, a*, and b* of the samples all decreased over the ripening.

2The conservation of historical artifacts, as a profession that closely linked to the prevailing history and culture in individual and social life, carries a heavy mission and responsibility towards the creators and owners of these artifacts in the past, present, and future. On the other hand, despite the diversity of thoughts, desires, and approaches, it is an activity that must be conducted within a specific scientific and theoretical framework. Conservators, while adhering to this specified framework, must also consider particular ethical considerations. These considerations are crucial not only for maintaining the quality and clarity of conservation activities for the conservators and their audience but also for making them aware of the ethical consequences of their actions and the ethical standards used to evaluate those actions. These ethical considerations have been variously addressed in the theories and documents related to the conservation and restoration field as the profession has evolved. In this research, an attempt is made to provide definitions and basic concepts related to the topic, alongside examples of ethical codes in the conservation profession with an interpretive approach. The aim of this research is to understand the role and function of ethics in conservation and restoration processes and some ethical considerations when dealing with artifacts. To this end, To this end, ethical conduct documents prepared by several conservation institutions, such as the American Institute for Conservation (AIC), the Canadian Association for Conservation (CAC), the International Council of Museums Committee for Conservation (ICOM-CC), the European Confederation of Conservator-Restorers' Organisations (ECCO), and the United Kingdom Institute for Conservation (UKIC), have been examined as case studies. The reviews revealed that these documents strive to define the boundaries of professional conservation, with the primary goal of protecting public assets and gaining public trust and social approval for the profession. Therefore, they focus on the interests of humanity rather than professional interests and develop conservation ethics based on attention to universal values and a focus on cultural values.

2Red mineral pigments, including minium, vermilion and ocher, have historically been some of the most important and widely used colors ranges in painting, gilding, tabulation and marking verses. This color spectrum in the artworks from previous centuries has shown acceptable stability, with its brightness well-preserved. The preparation of color, as one of the most a significant tools for artists, has long been an important issue, leading to the documentation of  color preparation methods in book design in book design treatises. Minium processing is mentioned as a red pigments in three treatises: Umdeh al-Kottab, Bayan al-Sana, at and Qanun al-Sovar. In the current research the text of these treatises were reviewed, and a comparative study of minium identified in a number of illustrated manuscripts from the Safavid period was carried out using colorimetric method. Initially for this purpose, in the first step, minium was mixed with specific ratios of vermilion to prepare red color tables based on minium. Eight samples of selected miniatures from Safavid period illustrated manuscripts (including 5 illustrated manuscripts from the National Museum of Iran) and 17 prepared color samples were subjected to spectral and color analysis using a spectrophotometer. The color difference values of the prepared samples and the historical samples were then calculated. The results indicate that there is an acceptable color difference between the prepared colors and the historical samples. Therefore, this method can be used in the reconstruction and homogenization of the red spectrum resulting from the minium pigment.