Silencing of CYP6CM1 gene of cotton whitefly Bemisia tabaci (Gennadius) using RNAi technique

Q: How can I download an article?

To download an article from SID, first log in to the site, search for the article title, and click on the 'Download Article' option.

Q: How can I download an ISI article?

To download an ISI article on SID, enter the keyword or article title in the search bar, view the relevant results, click on the desired article, and select the 'Download Article' option.

Q: How can I access the SID database?

To access the SID database, visit SID.ir, create an account, and log in to access scientific resources.

Q: Is downloading articles from SID free?

Some articles on SID are available for free, while others require payment. Details are specified on the article's page.

BASIJ M.; TALEBI KH.; HOSSEININAVEH V.; SALAMI S.A.R.

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

Journal Paper

Paper Information

Journal: Plant Protection Year:2019 | Volume:42 | Issue:1 Page(s): 79-89

Download Full-Text

Persian Verion

View:

338

Download:

Cites:

Information Journal Paper

Title

Silencing of CYP6CM1 gene of cotton whitefly Bemisia tabaci (Gennadius) using RNAi technique

Author(s)

BASIJ M. | TALEBI KH. | HOSSEININAVEH V. | SALAMI S.A.R. | Issue Writer Certificate

Keywords

Bemisia tabaciQ2

imidaclopridQ2

resistance to insecticideQ1

gene silencingQ1

CYP6CM1dsRNAQ1

Abstract

Background and objectives: The cotton whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), is a significant agricultural pest in arable lands and on ornamental crops in temperate regions of the world and has been shown to be capable of developing resistance to many classes of insecticides. Difficulties in controlling B. tabaci mainly result from its resistance to insecticides, including neonicotinoids. Neonicotinoids are a relatively new class of synthetic insecticides used primarily to control of whiteflies, B. tabaci is capable of developing resistance to different classes of insecticides as neonicotinoides. It has been experimentally proven that resistance of B. tabaci to imidacloprid is associated with overexpression of the P450 genes. RNA interference (RNAi) has been successfully applied in insects to study RNAi mechanisms and gene functions. In this study, the RNA interference (RNAi) effects of P450 CYP6CM1 as key gene in resistance to neonicotinoides on expression, resistance ratio and total P450 activities were evaluated. Material and Methods: Colony of whitefly reared on leaves of tomato plants in growth chamber at 25 ± 2 º C, 65± 5% RH and a photoperiod 16: 8 h (light: darkness). Total RNA was isolated from adult B. tabaci using Biosol reagent (Invitrogen). cDNA synthesis was performed using iScript cDNA Synthesis Kit (BIO-RAD). Double-stranded RNA (dsRNA) of P450 CYP6CM1 was synthesized using specific primers (3' TAATACGACTCACTATAGGG 5', 3' TAATACGACTCACTATAGGG 5'), the bioassay tests after introduce of dsRNA into the insect body of whitefly by oral delivery were carried out for 6 days, and mortality was recorded daily by counting the dead insects at the bottom of the tube. The LC50 and resistance ratio were calculated using Ploplus computer software. The amount of cytochrome P450 activity was measured using 7-ethoxycoumarin based on the microfluorimetric method. Quantification of mRNA expression levels was quantified using the comparative cross-threshold (CT) (the PCR cycle number that crosses the signal threshold) method. Results: Analysis of knockdown effects of CYP6CM1 on resistance was based on probit analysis and indicates that the gene is responsible for up to 5. 3-fold reduction in imidacloprid resistance of dsRNA-fed adults. Moderate, but significant reduction in total P450 activity (45 %) exhibited by microsomal proteins prepared from dsRNA-fed JR population adult when compared to the control (JR population without dsRNA-fed). The results of P450 CYP6CM1 mRNA expression levels showed decrease in mRNA levels of the target genes with increasing the time after feeding dsRNA. Results revealed that delivery dsRNA to adult insect's reduced CYP6CM1 expression up to 2-fold when comparing to the control. Discussion: Reduction in resistance ratio by 5. 3 fold after CYP6CM1 dsRNA fed in resistance population indicated the possibility of practical use of RNAi technique in insect resistance management (IRM) program for B. tabaci.

Cites

No record.

References

No record.

Cite

APA: Copy

BASIJ, M., TALEBI, KH., HOSSEININAVEH, V., & SALAMI, S.A.R.. (2019). Silencing of CYP6CM1 gene of cotton whitefly Bemisia tabaci (Gennadius) using RNAi technique. PLANT PROTECTION (SCIENTIFIC JOURNAL OF AGRICULTURE), 42(1 ), 79-89. SID. https://sid.ir/paper/405716/en

Vancouver: Copy

BASIJ M., TALEBI KH., HOSSEININAVEH V., SALAMI S.A.R.. Silencing of CYP6CM1 gene of cotton whitefly Bemisia tabaci (Gennadius) using RNAi technique. PLANT PROTECTION (SCIENTIFIC JOURNAL OF AGRICULTURE)[Internet]. 2019;42(1 ):79-89. Available from: https://sid.ir/paper/405716/en

IEEE: Copy

M. BASIJ, KH. TALEBI, V. HOSSEININAVEH, and S.A.R. SALAMI, “Silencing of CYP6CM1 gene of cotton whitefly Bemisia tabaci (Gennadius) using RNAi technique,” PLANT PROTECTION (SCIENTIFIC JOURNAL OF AGRICULTURE), vol. 42, no. 1 , pp. 79–89, 2019, [Online]. Available: https://sid.ir/paper/405716/en

Related Journal Papers