Plant Protection
Year:2019 | Volume:42 | Issue:1|Papers Count:7

Background and objectives: The cotton aphid, Aphis gossypii, is an important pest on greenhouse crops such as the cucumber. Natural enemies have often been used successfully to control greenhouse pests. Among different pests, aphids because of their high reproductive rate are particularly difficult to control biologically. Materials and Methods: In this study, the effects of separate and simultaneous application of the parasitoid wasp Lysiphlebus fabarum and the predator ladybird beetle Hippodamia variegata were studied to control A. gossypii on cucumber as an integrated pest management program. The replicates (n= 10) in all treatments included 10 cucumber plants in separate pots and were infected with five winged A. gossypii placed in a cage with a banker plant system of Vicia fabae-Aphis fabae. With the introduction of mummified aphids on a bean shoot (every two days), a pair of male and female adult ladybird beetles (every three days) or simultaneous application of both biocontrol agents, the numbers of aphids were counted in the three treatments. Results: The results revealed that the parasitoid wasp L. fabarum alone was unable to control A. gossypii, but H. variegata performed better. The best performance was observed for simultaneous application of both biocontrol agents. Moreover, in the combined agents’ treatment, the number of A. gossypii on the both lower and upper cucumber leaves was not significantly different compare to other treatments that biological agentswere used seperatly. The number of mummified aphids did not differ between treatments at the end of the experiments. This is indicative of the tendency for ladybird beetles to feed on different growth stages of non-parasitized aphids compare to parasitized aphids containing immature stages of L. fabarum. Discussion: The results indicate thatthe simultaneous application of both biocontrol agents is effective for the control of A. gossypii, although more research under greenhouse condition is needed.

Background and objectives: Large areas of non-irrigated wheat fields have recently gone through the damage caused by growing population of wheat chafers. To study wheat chafers’ population changes and their natural enemies, the larvae, pupae and adults were collected from Kermanshah and Kurdistan provinces. Materials and Methods: Sampling and counting of larvae and pupae were done by placing wooden quadrats over the wheat fields and digging soils of the sampled areas. The insect net was employed to capture the adults. The sampling was carried out for three years (2010-2013). Results: The two cockchafer species Tanyproctus ganglbaueri and Miltotrogus (Amphimallon) caucasicus (Scarabaeidae) were the most damaging chafers to wheat in western parts of Iran. The dominant species depended on the region and timespan indicating species turnover. The described species of T. ganglbaueri hasn’ t been reported yet as a pest worldwide. The highest density of M. caucasicus larvae in Kermanshah province was 5. 6 larvae per 0. 25 m2 quadrat in mid-April; while in case of T. ganglbaueri 16 larvae per 0. 25 m2 quadrat was recorded in March in Kurdistan province. Larvae of T. ganglbaueri started feeding in early February and the peak feeding times occured in March and April. The average adult lifespan of T. ganglbaueri was roughly 43 days. Fungal and bacterial pathogens including Beauveria bassiana, Hirsutella sp. and Bacillus sp. were isolated from the wheat chafers. Discussion: The relatively different biology of these two pest species has an implication in their timing control actions. More studies on identification and revision of wheat scarabs in different climates of Iran is needed.

Background and objectives: Fig mite, Eotetranychus hirsti Baker & Pritchard (Acari: Tetranychidae), is one of the most important pests of fig trees in Iran and most parts of the world. This pest causes the leaves to fall and reduce the quantity and quality of the product. Several different insecticides have been used to control this mite. Materials and Methods: Due to the consumption of fresh fig and in order to produce healthy crops and to develop non-chemical pesticides, the application of coconut botanical soap (Palizin® SL70%), red pepper extract (Tondexir® EC85%), and propargite (Omite® , EC57%, ) were tested in the fields of Bardaskan region, during 2015-2016. The botanical insecticides (1500 & 2000 ppm concentrations), propargite acaricide (2000 ppm) and water were sprayed over the whole canopy during July to August. Samplings were carried out one day before and 3, 7, 14, 21 and 28 days after spraying. At each sampling time, the total number of egg, larvae and active stages (nymph and imago) of fig mite on 4 leaves per tree were counted. Treatments were compared based on mortality rate and efficacy percentage. Data was analyzed based on a completely block randomized design using SAS software. Mean comparison was done using Tukey's test. Results: The results of this study showed that there was a significant difference between all treatments and different times, on all developmental stages of fig mite. Based on the field studies, the application of botanical components, including the red pepper extract, compared with the propargite acaricide, caused a further decrease in the population of fig mites. The highest mortality rates for eggs, larvae and active stages (nymph and imago) of fig mite were observed in red pepper extract and coconut botanical soap treatments, and the lowest mortality rates was recorded in control treatment. The mean efficacy percentage of red pepper extract (2000 ppm) treatment for eggs, larvae and active stages (nymph and imago) were 97. 9, 95. 1, 92. 2 in 3 days, 98. 7, 94. 2, 93. 5 in 7 days, 96. 0, 88. 9, 89. 3 in 14 days, 98. 8, 93. 7, 92. 8 in 21 days and 97. 1, 96. 8 and 92. 7 in 28 days after spraying, respectively. Also, the mean efficacy percentage of coconut botanical soap (2000 ppm) treatment for egg, larvae and active stages (nymph and imago) were 88. 9, 89. 2, 87. 0 in 3 days, 89. 2, 87. 7, 86. 3 in 7 days, 87. 1, 86. 0, 87. 6 in 14 days, 86. 6, 83. 5, 83. 4 in 21 days and 87. 5, 87. 6 and 90. 9 in 28 days after spraying, respectively. Discussion: Therefore, red pepper extract (Tondexir® ) spraying with 2000 ppm concentration, over the whole canopy of figs trees, were effective in decreasing fig mite damage.

Background and objectives: The tomato leaf miner, Tuta absoluta (Meyrick) is the most damaging tomato insect pest. In the present study, the lethal effects of plant insecticide, tondexir (Tondexir® ) and chemical insecticide, indoxacarb (Avaunt® ) were assessed against T. absoluta under laboratory and field conditions. Materials and Methods: The sublethal (LC30) effects of the insecticides were evaluated on the life table parameters of T. absoluta. The potter tower was used for the bioassays. In order to define the effect of these compounds, an experimental field was carried out in a randomized complete block design with three treatments replicated four times during two consecutive seasons in 2017 and 2018. Results: The LC50values of tondexir and indoxacarb on eggs of T. absoluta were 837. 9 and 1139. 1 ppm, respectively. Sublethal concentration of insecticides affected life table parameters of T. absoluta significantly. Embryonic, larval, pupal and TPOP periods were significantly higher in tondexir than the control. Intrinsic rate of increase (rm) value in both insecticides treatments was significantly lower than control (P<0. 05). The minimum value of λ (1. 105 day-1) and the longest generation time (39. 36 day) was observed in tondexir. The persistency effect of tested insecticides under field conditions was higher in tondexir than indoxacarb. Even 21 days after treatment, the percentage mortality of eggs and larvae of T. absoluta were significantly higher in plot that treated with tondexir than indoxacarb treatment. Discussion: The total results revealed that tondexir had high lethal and sublethal effects on tomato leafminer and can be recommendable to be applied in an integrated pest management program (IPM) of this pest.

Background and objectives: Cereal cyst nematodes (CCNs) are acknowledged globally as a biotic constraint for wheat production, particularly under rain-fed conditions and drought stress. Among species of CCNs, Heterodear filipjevi is the dominant species in most cereal growing areas of Iran and is widespread in different regions of the country. The use of resistant wheat cultivars is considered the most effective and economical method for managing cereal cyst nematodes. The effectiveness of resistance to CCNs depends on the efficiency and durability of the sources of resistance, and on the correct identification of the nematode species and pathotype(s) present in each region. The objective of this study was to assess the reaction of common accessions of bread wheat to H. filipjevi under greenhouse conditions. Materials and Methods: The reaction of common accessions of bread wheat, including some cultivars and lines (20 accessions) to H. filipjevi was assessed according to used method for screening of wheat accessions under controlled conditions. Single wheat seeds were planted in standard small tubes. After plant emergence, tubes were inoculated with 300 freshly hatched J2 in 3 holes around the stem base. Experimental units were arranged in a randomized complete block design with 5 replicates. Plants were harvested 8 weeks after juvenile inoculation. Extracted Cysts from both root and soil counted under a stereomicroscope. The data were analyzed and the genotypes were divided into different groups based on their reactions. Results: The results showed that Back-cross Rowshan cultivar with mean 30. 2 and Silverstar cultivar with mean 6. 8 had the most and the least number of cysts in soil and root of each plant, respectively. Cluster analysis divided all accessions into 4 groups. Back-cross Rowshan, Pishtaz and Pishgam cultivars were identified as highly susceptible according to higher mean of the cyst number in soil and root, in comparison to Bezostaya cultivar (Susceptible check). Mahdavi, Bam, Dena, Bahar, Sivand, Ofogh, Arg and Bezostaya cultivars were categorized as susceptible. Rowshan, Alvand, Parsi, Es-93-95 and Marvdasht accessions were grouped as moderately susceptible, and, Sirvan, M-90-9, M-90-7 and Silverstar (Moderately resistant check) accessions were identified as moderately resistant. Discussion: This study revealed that Back-cross Rowshan, Pishtaz and Pishgam are highly susceptible cultivars to H. filipjevi. However, the cultivation of these wheat cultivars is common in the country. In order to impeding the damage of this nematode, it is essential to avoid cultivating these cultivars and other susceptible cultivars in infested fields to H. filipjevi.

Background and objectives: The cotton whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), is a significant agricultural pest in arable lands and on ornamental crops in temperate regions of the world and has been shown to be capable of developing resistance to many classes of insecticides. Difficulties in controlling B. tabaci mainly result from its resistance to insecticides, including neonicotinoids. Neonicotinoids are a relatively new class of synthetic insecticides used primarily to control of whiteflies, B. tabaci is capable of developing resistance to different classes of insecticides as neonicotinoides. It has been experimentally proven that resistance of B. tabaci to imidacloprid is associated with overexpression of the P450 genes. RNA interference (RNAi) has been successfully applied in insects to study RNAi mechanisms and gene functions. In this study, the RNA interference (RNAi) effects of P450 CYP6CM1 as key gene in resistance to neonicotinoides on expression, resistance ratio and total P450 activities were evaluated. Material and Methods: Colony of whitefly reared on leaves of tomato plants in growth chamber at 25 ± 2 º C, 65± 5% RH and a photoperiod 16: 8 h (light: darkness). Total RNA was isolated from adult B. tabaci using Biosol reagent (Invitrogen). cDNA synthesis was performed using iScript cDNA Synthesis Kit (BIO-RAD). Double-stranded RNA (dsRNA) of P450 CYP6CM1 was synthesized using specific primers (3' TAATACGACTCACTATAGGG 5', 3' TAATACGACTCACTATAGGG 5'), the bioassay tests after introduce of dsRNA into the insect body of whitefly by oral delivery were carried out for 6 days, and mortality was recorded daily by counting the dead insects at the bottom of the tube. The LC50 and resistance ratio were calculated using Ploplus computer software. The amount of cytochrome P450 activity was measured using 7-ethoxycoumarin based on the microfluorimetric method. Quantification of mRNA expression levels was quantified using the comparative cross-threshold (CT) (the PCR cycle number that crosses the signal threshold) method. Results: Analysis of knockdown effects of CYP6CM1 on resistance was based on probit analysis and indicates that the gene is responsible for up to 5. 3-fold reduction in imidacloprid resistance of dsRNA-fed adults. Moderate, but significant reduction in total P450 activity (45 %) exhibited by microsomal proteins prepared from dsRNA-fed JR population adult when compared to the control (JR population without dsRNA-fed). The results of P450 CYP6CM1 mRNA expression levels showed decrease in mRNA levels of the target genes with increasing the time after feeding dsRNA. Results revealed that delivery dsRNA to adult insect's reduced CYP6CM1 expression up to 2-fold when comparing to the control. Discussion: Reduction in resistance ratio by 5. 3 fold after CYP6CM1 dsRNA fed in resistance population indicated the possibility of practical use of RNAi technique in insect resistance management (IRM) program for B. tabaci.

Background and objectives: The use of chemical pesticides has caused environmental hazards as well as the creation of residues on food products. In this research, the extracts of Zataria multifloraBoiss. and Garlic (Allium sativum L. ) were used for controlling the green mold of orange caused by Penicillium digitatum, invitro and invivo at 15 ̊ C. Materials and Methods: In this study, the effect of plant extracts against the pathogen was evaluated using two methods, included the paper disc and mixing with culture media. Then, the effect of these extracts on the fruit was studied against the pathogen. The level of activity of the enzymes including peroxidase, catalase and polyphenol oxidase, as well as total phenol content were measured. Finally, the expression of catalase, peroxidase and polyphenol oxidase genes was evaluated using the Real time PCR method. Results: The results of disc test showed that aqueous and alcoholic extracts of garlic had the highest effect on fungal mycelium growth with 60 mg at ml concentration and 32. 20 mm and 26. 12 mm diameter of inhibition zone respectively. The mixing culture test showed that aqueous and alcoholic extracts of garlic with 65. 25 and 75. 26 percent of the inhibitory effect on the pathogen, respectively, showed the best control compared to the control in 600 mg at L concentration. The results of invivo assays indicated that 6×1000 concentration of aqueous and alcoholic garlic and thyme extracts had the lowest of decay area with 5. 3 and 3. 26 cm2 respectively (for garlic) and 7. 44 and 4. 15 cm2 for thyme. Results of enzyme activity of peroxidase and polyphenol oxidase showed that the highest activity of both enzymes was 9 days after sampling and in the treatment of 6×1000 garlic extract. Discussion: Based on the results of laboratory and storage tests, the extract of both garlic and thyme are introduced as natural constituents with controlled potentials. The genes expression levels of enzymes as peroxidase, polyphenol oxidase, and phenylalanine ammonialis had the same trend to the activity of two enzymes over a period of 12 days. Based on the results of invivo and invitrotests, the extract of garlic and thyme are introduced as natural compounds with high controlling potentials.