مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

Persian Verion

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

video

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

sound

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

Persian Version

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View:

641
مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

Download:

0
مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

Cites:

Information Journal Paper

Title

Proprietary diagnosis of aflatoxin G1 based on aptasensor colorimetry using gold nanoparticles Suspension

Pages

  433-439

Abstract

 2Introduction: When the size of a material is reduced to the nanometer length scale, the electron properties and therefore its chemical properties change greatly. In nanoparticles such as gold and silver, the coherent oscillation of electrons in the conduction strip creates large surface electric fields which, when they interact with electromagnetic resonance radiation, their radiant properties rises sharply. This process causes the absorption process of these nanoparticles to be several times stronger than the absorption process of the strongest adsorbent molecules and their scattered light is several times more intense than the organic materials fluorescence. These unique properties provide a high potential for these nanoparticles to be used in many applications such as biochemical sensors, biomedical imaging and medical treatments. Aptamers are single-stranded oligonucleotides, DNA, RNA or proprietary proteins that have the ability to attach specifically to their target. The basis for identifying the target by Aptamers is the third structure formed by them. One of the important benefits of Aptamers to antibodies is their smaller size, which makes them more easily and effectively penetrated. It also has neither toxicity nor immunogenicity unless in very low levels. Therefore, Biosensors that use Aptamers as biological identifiers are known as aptasensors. In this research, due to the high losses caused by Aflatoxins to the crops and their toxicity, the rapid detection of these pesticides by aptasensor method was investigated. Materials and methods: The test was carried out in a 96-well plate and for each concentration three replicates were considered. In each test, 100 μ l of the nano gold solution, which was centrifuged twice at 12000 rpm and at room temperature, was thrown into 11 concentrations and three repetitions in the plate houses. Then adding 15 μ lit of Aptamer at a concentration of 5 μ mol plus 10 μ lit of distilled ultrapure water to the houses and incubate for 30 minutes at room temperature. After this time, 25 μ lit of different concentrations of Aflatoxin plus 15 μ lit of 2 molar salt solutions and 35 μ lit of distilled water were added to the houses and, after mixing (up and down) in the ELISA reader, absorbed it we read. Results and discussions: At first, with adding the Aptamer to Nano gold particles a complex between nanoparticles and Aptamer is created. But in present of suitable Aflatoxin, the complex of nanoparticle and Aptamer is separated and a new complex between Aflatoxin and nanoparticle is formed. Subsequently the color is changed to purple. This color change is visible to the eye, indicating that the Aptamer is suitable for Target. In this study, it was found that an Aptamer with GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA sequence only affects Aflatoxin G1 and other Aflatoxins such as B1, B2, and G2 should be considered as another sequencer for Aptamer.

Cites

  • No record.
  • References

  • No record.
  • Cite

    APA: Copy

    Hashemnia, A., & HAKIMZADEH, V.. (2019). Proprietary diagnosis of aflatoxin G1 based on aptasensor colorimetry using gold nanoparticles Suspension. IRANIAN FOOD SCIENCE AND TECHNOLOGY RESEARCH JOURNAL, 15(4 (58) ), 433-439. SID. https://sid.ir/paper/366096/en

    Vancouver: Copy

    Hashemnia A., HAKIMZADEH V.. Proprietary diagnosis of aflatoxin G1 based on aptasensor colorimetry using gold nanoparticles Suspension. IRANIAN FOOD SCIENCE AND TECHNOLOGY RESEARCH JOURNAL[Internet]. 2019;15(4 (58) ):433-439. Available from: https://sid.ir/paper/366096/en

    IEEE: Copy

    A. Hashemnia, and V. HAKIMZADEH, “Proprietary diagnosis of aflatoxin G1 based on aptasensor colorimetry using gold nanoparticles Suspension,” IRANIAN FOOD SCIENCE AND TECHNOLOGY RESEARCH JOURNAL, vol. 15, no. 4 (58) , pp. 433–439, 2019, [Online]. Available: https://sid.ir/paper/366096/en

    Related Journal Papers

    Related Seminar Papers

  • No record.
  • Related Plans

  • No record.
  • Recommended Workshops






    Move to top
    telegram sharing button
    whatsapp sharing button
    linkedin sharing button
    twitter sharing button
    email sharing button
    email sharing button
    email sharing button
    sharethis sharing button